ID 21-W377
Registered: 2009.09.10 Last update: 2011.04.22
| Gene Name | zinc finger protein 13 | Gene Symbol | Zfp13 | |||
| Chromosome | 17 | Genomic Location | chr17:23,712,000-23,737,000 |  |
||
| Synonyms | Zfp-13, Krox-8, AI835008, 4933429B21 | |||||
| Links |
UCSC Genome Browser(chr17:23,712,000-23,737,000) NCBI Gene(22654) IGTC(Zfp13,6936) UNIGene(Mm.40326) |
MGI(99159) KEGG GENES(mmu:22654) EST Profile(mm.40326) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB520832 | GSS Location | chr17:23,736,009-23,736,067 | Size | 59 |
| Sequence | GGAGGCGCGGCGAGCAGGGTGAAGGAGTGGAGAGCTTTCTCTAACAGCAGCTGGGCACA | ||||
| Links |
UCSC Browser(chr17:23,736,009-23,736,067) IGTC(Ayu21-W377) |
||||
Homology Search Results
Mouse Information
| Card ID | 1695 | ||||
| Strain Name | B6;CB-Zfp13Gt(pU-21W)377Card | ||||
| Internal Code | Ayu21-W377 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Zfp13) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |