ID 21-W379
Registered: 2009.10.17 Last update: 2010.01.05
| Gene Name | nuclear receptor co-repressor 2 | Gene Symbol | Ncor2 | |||
| Chromosome | 5 | Genomic Location | chr5:125,495,000-125,665,000 |  |
||
| Synonyms | SMRT, N-CoR, SMRTe | |||||
| Links |
UCSC Genome Browser(chr5:125,495,000-125,665,000) NCBI Gene(20602) IGTC(Ncor2,2147) UNIGene(Mm.278646) |
MGI(1337080) KEGG GENES(mmu:20602) EST Profile(mm.278646) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB525788 | GSS Location | chr5:125,633,977-125,659,496 | Size | 177 |
| Sequence | CCCGCGCGTCCGGGCCCCGCGTCGTAGCGCGGCGGGCGGAGACCGCAGGCTCTCAGCCCGGACCC GCCGCATCCTCGAGCCCGATCGGCGCCGTAGCCCGGCGCCAGCGCCCGGTGCCGCCGCCGGCGAA GTGCTCCTGAGTCTTTGAGGAACACAGCCTCCTGGTGGAAGTTCGTG |
||||
| Links |
UCSC Browser(chr5:125,633,977-125,659,496) IGTC(Ayu21-W379) |
||||
Homology Search Results
| [NM_011424] Mus musculus nuclear receptor co-repressor 2 (Ncor2), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ncor2) |
||||