Gene Name | WAS protein family, member 2 | Gene Symbol | Wasf2 | |||
Chromosome | 4 | Genomic Location | chr4:132,686,000-132,757,000 | ![]() |
||
Synonyms | WAVE2, AW742646, D4Ertd13e | |||||
Links |
UCSC Genome Browser(chr4:132,686,000-132,757,000) NCBI Gene(242687) IGTC(Wasf2,165) UNIGene(Mm.23566) |
MGI(1098641) KEGG GENES(mmu:242687) EST Profile(mm.23566) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB517996 | GSS Location | Size | 173 | |
Sequence | AAATCGCGTAATGGCGGACTCAGGCCGGTGGAGTGCGGCTGGGGGCGTAGCGCGCTGAGGGGGGC GTCCGGCTGAGTAGCAGCCCGCGAAGCAGTAGGCTGGACCGTTCTCCGTGGGGACGCGGACCGGC TGCCCAGCCCTTCATGTCGCTGAGGGCGACTGCGCGAGGTCAG |
||||
Links |
UCSC Browser() IGTC(Ayu21-W382) |
[CJ175118] CJ175118 RIKEN full-length enriched mouse cDNA library, Rathke's pouches 14.5 days embryo Mus musculus cDNA clone M130047G16 5', mRNA sequence. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Wasf2) |