ID 21-W392
Registered: 2009.11.17 Last update: 2011.04.22
| Gene Name | RIKEN cDNA 6820431F20 gene | Gene Symbol | 6820431F20Rik | |||
| Chromosome | 8 | Genomic Location | chr8:19,980,000-20,021,000 |  |
||
| Synonyms | 2610005L07Rik, 2810038F24Rik, 6720476A01Rik | |||||
| Links |
UCSC Genome Browser(chr8:19,980,000-20,021,000) NCBI Gene(381598) IGTC(6820431F20Rik,1557) UNIGene(Mm.359054) |
MGI(3694236) KEGG GENES(mmu:) EST Profile(mm.359054) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB533332 | GSS Location | chr8:20,020,170-20,020,287 | Size | 119 |
| Sequence | GCACAGGGCAAAGATGGCGGCGGAGGAGCAGGAGGCTTTGAGGGAGTTCATGGCGGTGACGGGCA CTGAGGAGGAAAGGGCTCGTTTCGTACCTGGAGACGGCTGGCTGGGACCTGCAG |
||||
| Links |
UCSC Browser(chr8:20,020,170-20,020,287) IGTC(Ayu21-W392) |
||||
Homology Search Results
| [NR_030708] Mus musculus RIKEN cDNA 6820431F20 gene (6820431F20Rik), non-coding RNA. |
Mouse Information
| Card ID | 1696 | ||||
| Strain Name | B6;CB-6820431F20RikGt(pU-21W)392Card | ||||
| Internal Code | Ayu21-W392 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for 6820431F20Rik) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |