ID 21-W394
Registered: 2009.10.17 Last update: 2010.01.05
| Gene Name | prostate transmembrane protein, androgen induced 1 | Gene Symbol | Pmepa1 | |||
| Chromosome | 2 | Genomic Location | chr2:173,048,000-173,103,000 |  |
||
| Synonyms | Stag1, Erg1.2, N4wbp4,Tmepai; AW455466, 2210418I02Rik | |||||
| Links |
UCSC Genome Browser(chr2:173,048,000-173,103,000) NCBI Gene(65112) IGTC(Pmepa1,15541) UNIGene(Mm.73682) |
MGI(1929600) KEGG GENES(mmu:65112) EST Profile(mm.73682) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB525789 | GSS Location | chr2:173,101,589-173,101,741 | Size | 153 |
| Sequence | GCCGGAGCCGCCCCCGCGCCCCGCGCCTCGCGCCCCGCGCCGCCCGTGACCGCTTGATGGGGGTC AACGGCACCGCCGCCGCCGCCGCCGGGCAGCCCAATGTCTCCTGCGCGTGCAACTGCCAGCGCTC TTTGTTCCCCAGCATGGAGATCA |
||||
| Links |
UCSC Browser(chr2:173,101,589-173,101,741) IGTC(Ayu21-W394) |
||||
Homology Search Results
| [NM_022995] Mus musculus prostate transmembrane protein, androgen induced 1 (Pmepa1), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Pmepa1) |
||||