ID 21-W397
Registered: 2009.10.17 Last update: 2013.02.15
| Gene Name | predicted gene 11520 | Gene Symbol | Gm11520 | |||
| Chromosome | 11 | Genomic Location | chr11:95,166,405-95,187,149 |  |
||
| Synonyms | OTTMUSG00000001656 | |||||
| Links |
UCSC Genome Browser(chr11:95,166,405-95,187,149) NCBI Gene(103727) IGTC(Gm11520,) UNIGene(Mm.) |
MGI(3650534) KEGG GENES(mmu:) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB525791 | GSS Location | chr11:95,171,641-95,171,767 | Size | 127 |
| Sequence | TTTTGGAATTGGGCAGGAGACGGCACCAGTGGTGAAACCTTCGGCTAGACCTTTTTAGTTAGGTA GGCGGCATTCGTGTGGGATTAGGTAGCCATGATTGTTTGGGGCAGAAGTCTGGCAGTTGAAG |
||||
| Links |
UCSC Browser(chr11:95,171,641-95,171,767) IGTC(Ayu21-W397) |
||||
Homology Search Results
| [BY334693] BY334693 RIKEN full-length enriched, synovial fibroblasts Mus musculus cDNA clone L130039A14 5', mRNA sequence. |
Mouse Information
| Card ID | 1911 | ||||
| Strain Name | B6;CB-<i>Gm11520<sup>Gt(pU-21W)397Card</sup></i> | ||||
| Internal Code | Ayu21-W397 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). In this clone, the anti-sense RNA gene of Myst2 gene might be trapped. Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Gm11520) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |