Gene Name | sterol regulatory element binding factor 2 | Gene Symbol | Srebf2 | |||
Chromosome | 15 | Genomic Location | chr15:81,977,000-82,037,000 | ![]() |
||
Synonyms | SREBP2, bHLHd2, SREBP-2, AI608257, SREBP2gc | |||||
Links |
UCSC Genome Browser(chr15:81,977,000-82,037,000) NCBI Gene(20788) IGTC(Srebf2,2535) UNIGene(Mm.38016) |
MGI(107585) KEGG GENES(mmu:20788) EST Profile(mm.38016) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB525792 | GSS Location | chr15:81,977,694-81,977,920 | Size | 227 |
Sequence | TCAAACATGGCGGCGGTTGGCACGGGGCGGTGAGGCGGTACCAGGTGGGGGCTGTCGGGTGTCAT GGGCGGTGGCGGCGGTACCGCCTCCGCGTCTCCCTGAGCTGGACCTCACGGGGGACTCTGCGCCA AGCTGGGCGATGGATGAGAGCAGCGAGCTGGGCGTTCTGGAGACCATGGAGACCCTCACGGAGCT GGGCGATGAGCTGACTCTCGGGGACATCGACG |
||||
Links |
UCSC Browser(chr15:81,977,694-81,977,920) IGTC(Ayu21-W399) |
[NM_033218] Mus musculus sterol regulatory element binding factor 2 (Srebf2), mRNA. |
Card ID | 1679 | ||||
Strain Name | B6;CB-Srebf2Gt(pU-21W)399Card | ||||
Internal Code | Ayu21-W399 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Srebf2) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |