ID 21-W399
Registered: 2009.10.18 Last update: 2011.04.14
| Gene Name | sterol regulatory element binding factor 2 | Gene Symbol | Srebf2 | |||
| Chromosome | 15 | Genomic Location | chr15:81,977,000-82,037,000 |  |
||
| Synonyms | SREBP2, bHLHd2, SREBP-2, AI608257, SREBP2gc | |||||
| Links |
UCSC Genome Browser(chr15:81,977,000-82,037,000) NCBI Gene(20788) IGTC(Srebf2,2535) UNIGene(Mm.38016) |
MGI(107585) KEGG GENES(mmu:20788) EST Profile(mm.38016) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB525792 | GSS Location | chr15:81,977,694-81,977,920 | Size | 227 |
| Sequence | TCAAACATGGCGGCGGTTGGCACGGGGCGGTGAGGCGGTACCAGGTGGGGGCTGTCGGGTGTCAT GGGCGGTGGCGGCGGTACCGCCTCCGCGTCTCCCTGAGCTGGACCTCACGGGGGACTCTGCGCCA AGCTGGGCGATGGATGAGAGCAGCGAGCTGGGCGTTCTGGAGACCATGGAGACCCTCACGGAGCT GGGCGATGAGCTGACTCTCGGGGACATCGACG |
||||
| Links |
UCSC Browser(chr15:81,977,694-81,977,920) IGTC(Ayu21-W399) |
||||
Homology Search Results
| [NM_033218] Mus musculus sterol regulatory element binding factor 2 (Srebf2), mRNA. |
Mouse Information
| Card ID | 1679 | ||||
| Strain Name | B6;CB-Srebf2Gt(pU-21W)399Card | ||||
| Internal Code | Ayu21-W399 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Srebf2) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |