ID 21-W404
Registered: 2009.10.18 Last update: 2011.02.10
| Gene Name | branched chain ketoacid dehydrogenase E1, alpha polypeptide | Gene Symbol | Bckdha | |||
| Chromosome | 7 | Genomic Location | chr7:26,412,000-26,445,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr7:26,412,000-26,445,000) NCBI Gene(12039) IGTC(Bckdha,39208) UNIGene(Mm.25848) |
MGI(107701) KEGG GENES(mmu:12039) EST Profile(mm.25848) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB525793 | GSS Location | chr7:26,443,652-26,443,753 | Size | 102 |
| Sequence | ATAGTGATGTCTGCGGCCAAGATCTGGAGGCCGAGCCGTGGCCTGCGCCAGGCTGCTCTTCTCCT GTTGGGACGATCTGGGGTTCGGGGCTTGGCTAGATCT |
||||
| Links |
UCSC Browser(chr7:26,443,652-26,443,753) IGTC(Ayu21-W404) |
||||
Homology Search Results
| [NM_007533] Mus musculus branched chain ketoacid dehydrogenase E1, alpha polypeptide (Bckdha), nuclear gene encoding mitochondrial protein, mRNA. |
Mouse Information
| Card ID | 1745 | ||||
| Strain Name | B6;CB-BckdhaGt(pU-21W)404Card | ||||
| Internal Code | Ayu21-W404 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Bckdha) |
||||