Gene Name | protein O-fucosyltransferase 2 | Gene Symbol | Pofut2 | |||
Chromosome | 10 | Genomic Location | chr10:76,721,800-76,733,000 | ![]() |
||
Synonyms | FUT13, MGC6943, AI256847, BC003494, C21orf80, MGC25565, 2310011G23Rik | |||||
Links |
UCSC Genome Browser(chr10:76,721,800-76,733,000) NCBI Gene(80294) IGTC(Pofut2,7551) UNIGene(Mm.203556) |
MGI(1916863) KEGG GENES(mmu:80294) EST Profile(mm.203556) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB525794 | GSS Location | chr10:76,722,055-76,722,198 | Size | 144 |
Sequence | GGCCGCCGGGGCCATGGCGGCGCTCAGCGTCGTCTGCCTGCTGCTGGCAGCGGCATCCTGGCGGC CGGTCTCGGCTTCAGGAGAAGAATTCTGGCCTGGCCAGTCGGCGGCGGACATCCTGTCGGGGGCG GCATCCCGCAGACG |
||||
Links |
UCSC Browser(chr10:76,722,055-76,722,198) IGTC(Ayu21-W408) |
[NM_030262] Mus musculus protein O-fucosyltransferase 2 (Pofut2), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Pofut2) |