ID 21-W412
Registered: 2010.11.23 Last update: 2012.01.16
| Gene Name | RAB geranylgeranyl transferase, b subunit | Gene Symbol | Rabggtb | |||
| Chromosome | 3 | Genomic Location | chr3:153,570,000-153,576,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr3:153,570,000-153,576,000) NCBI Gene(19352) IGTC(Rabggtb,2984) UNIGene(Mm.277831) |
MGI(99537) KEGG GENES(mmu:19352) EST Profile(mm.277831) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB601827 | GSS Location | chr3:153,574,889-153,574,997 | Size | 123 |
| Sequence | CGGCGGTCGGACATGGGCACACAGCAGAAAGACGTTACTATCAAGTCAGATGCGCCTGACACCCT GTTGCTGGAGAAGCATGCCGATTATATTGCTTCCTATGGCTCAAAGAAAGATGATTAT |
||||
| Links |
UCSC Browser(chr3:153,574,889-153,574,997) IGTC(Ayu21-W412) |
||||
Homology Search Results
| [NM_011231] Mus musculus RAB geranylgeranyl transferase, b subunit (Rabggtb), transcript variant 1, mRNA. |
Mouse Information
| Card ID | 1832 | ||||
| Strain Name | B6;CB-<i>Rabggtb<sup>Gt(pU-21W)412Card</sup></i> | ||||
| Internal Code | Ayu21-W412 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rabggtb) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |