ID 21-W414
Registered: 2009.12.02 Last update: 2011.04.14
| Gene Name | ST3 beta-galactoside alpha-2,3-sialyltransferase 4 | Gene Symbol | St3gal4 | |||
| Chromosome | 9 | Genomic Location | chr9:34,850,000-34,940,000 |  |
||
| Synonyms | Siat4c | |||||
| Links |
UCSC Genome Browser(chr9:34,850,000-34,940,000) NCBI Gene(20443) IGTC(St3gal4,23521) UNIGene(Mm.275973) |
MGI(1316743) KEGG GENES(mmu:20443) EST Profile(mm.275973) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB535728 | GSS Location | chr9:34,924,283-34,924,453 | Size | 171 |
| Sequence | CCCCCGCCTCCCCTTCAGGCGGAATTGCCCGCTCCCAGGCCGGCCCCGCTCCCGGGACAGGGACC GGGCCGAGCGGAGCCACTGCGCCAGTGCTGCCCCGCCAGTCGGGGCGCCCAACGGATCGGAGCTG CGCGCGGATTTACCTCGCCCCGCCCCGCTCCACCCGCGAGG |
||||
| Links |
UCSC Browser(chr9:34,924,283-34,924,453) IGTC(Ayu21-W414) |
||||
Homology Search Results
| [NM_009178] Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (St3gal4), mRNA. |
Mouse Information
| Card ID | 1680 | ||||
| Strain Name | B6;CB-St3gal4Gt(pU-21W)414Card | ||||
| Internal Code | Ayu21-W414 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for St3gal4) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |