Gene Name | ST3 beta-galactoside alpha-2,3-sialyltransferase 4 | Gene Symbol | St3gal4 | |||
Chromosome | 9 | Genomic Location | chr9:34,850,000-34,940,000 | ![]() |
||
Synonyms | Siat4c | |||||
Links |
UCSC Genome Browser(chr9:34,850,000-34,940,000) NCBI Gene(20443) IGTC(St3gal4,23521) UNIGene(Mm.275973) |
MGI(1316743) KEGG GENES(mmu:20443) EST Profile(mm.275973) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB535728 | GSS Location | chr9:34,924,283-34,924,453 | Size | 171 |
Sequence | CCCCCGCCTCCCCTTCAGGCGGAATTGCCCGCTCCCAGGCCGGCCCCGCTCCCGGGACAGGGACC GGGCCGAGCGGAGCCACTGCGCCAGTGCTGCCCCGCCAGTCGGGGCGCCCAACGGATCGGAGCTG CGCGCGGATTTACCTCGCCCCGCCCCGCTCCACCCGCGAGG |
||||
Links |
UCSC Browser(chr9:34,924,283-34,924,453) IGTC(Ayu21-W414) |
[NM_009178] Mus musculus ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (St3gal4), mRNA. |
Card ID | 1680 | ||||
Strain Name | B6;CB-St3gal4Gt(pU-21W)414Card | ||||
Internal Code | Ayu21-W414 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for St3gal4) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |