ID 21-W419
Registered: 2010.02.07 Last update: 2011.08.19
| Gene Name | solute carrier family 45, member 3 | Gene Symbol | Slc45a3 | |||
| Chromosome | 1 | Genomic Location | chr1:133,858,500-133,880,000 |  |
||
| Synonyms | PRST, IPCA-6, Pcanap6, AU023994, AU043764, MGC32471, Prostein, 2210413P12Rik | |||||
| Links |
UCSC Genome Browser(chr1:133,858,500-133,880,000) NCBI Gene(212980) IGTC(Slc45a3,) UNIGene(Mm.200307) |
MGI(1922082) KEGG GENES(mmu:212980) EST Profile(mm.200307) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB545857 | GSS Location | chr1:133,859,518-133,859,606 | Size | 89 |
| Sequence | CCCCCCACTGAGTAACCTGGAGATTTAAAAGGCGCCCGCTGGCGCGCGTTGGTGAAGCAGGGGTC CGAGCTCGCACGCGCCAGCCCCAG |
||||
| Links |
UCSC Browser(chr1:133,859,518-133,859,606) IGTC(Ayu21-W419) |
||||
Homology Search Results
| [NM_145977] Mus musculus solute carrier family 45, member 3 (Slc45a3), mRNA. |
Mouse Information
| Card ID | 1753 | ||||
| Strain Name | B6;CB-<i>Slc45a3<sup>Gt(pU-21W)419Card</sup></i> | ||||
| Internal Code | Ayu21-W419 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Slc45a3) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |