Gene Name | solute carrier family 45, member 3 | Gene Symbol | Slc45a3 | |||
Chromosome | 1 | Genomic Location | chr1:133,858,500-133,880,000 | ![]() |
||
Synonyms | PRST, IPCA-6, Pcanap6, AU023994, AU043764, MGC32471, Prostein, 2210413P12Rik | |||||
Links |
UCSC Genome Browser(chr1:133,858,500-133,880,000) NCBI Gene(212980) IGTC(Slc45a3,) UNIGene(Mm.200307) |
MGI(1922082) KEGG GENES(mmu:212980) EST Profile(mm.200307) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB545857 | GSS Location | chr1:133,859,518-133,859,606 | Size | 89 |
Sequence | CCCCCCACTGAGTAACCTGGAGATTTAAAAGGCGCCCGCTGGCGCGCGTTGGTGAAGCAGGGGTC CGAGCTCGCACGCGCCAGCCCCAG |
||||
Links |
UCSC Browser(chr1:133,859,518-133,859,606) IGTC(Ayu21-W419) |
[NM_145977] Mus musculus solute carrier family 45, member 3 (Slc45a3), mRNA. |
Card ID | 1753 | ||||
Strain Name | B6;CB-<i>Slc45a3<sup>Gt(pU-21W)419Card</sup></i> | ||||
Internal Code | Ayu21-W419 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Slc45a3) |
Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
---|---|
Image | Male Female |