Gene Name | arylformamidase | Gene Symbol | Afmid | |||
Chromosome | 11 | Genomic Location | chr11:117,686,000-117,702,000 | ![]() |
||
Synonyms | Kf, Ammd, formylase, 9030621K19Rik | |||||
Links |
UCSC Genome Browser(chr11:117,686,000-117,702,000) NCBI Gene(71562) IGTC(Afmid,34475) UNIGene(Mm.273958) |
MGI(2448704) KEGG GENES(mmu:71562) EST Profile(mm.273958) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB533336 | GSS Location | chr11:117,687,241-117,687,320 | Size | 80 |
Sequence | GACCATCCCCTCCGGATCTGGCCATGGCGTTTCCTTCCCTTTCTGCGGGCCAGAATCCCTGGAGG AACTTGTCTTCGGAG |
||||
Links |
UCSC Browser(chr11:117,687,241-117,687,320) IGTC(Ayu21-W421) |
[NM_027827] Mus musculus arylformamidase (Afmid), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Afmid) |