ID 21-W431
Registered: 2010.05.02 Last update: 2018.10.27
| Gene Name | microtubule-associated protein 7 | Gene Symbol | Map7 | |||
| Chromosome | 10 | Genomic Location | chr10:19,868,000-20,002,000 |  |
||
| Synonyms | Mtap7, ste, MAP7, mshi, mste, R75000, E-MAP-115 | |||||
| Links |
UCSC Genome Browser(chr10:19,868,000-20,002,000) NCBI Gene(17761) IGTC(Map7,8846) UNIGene(Mm.20928) |
MGI(1328328) KEGG GENES(mmu:17761) EST Profile(mm.20928) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB558982 | GSS Location | chr10:19,868,795-19,868,886 | Size | 92 |
| Sequence | TCTCCCGGCGCGTCATCGGAGCACCATGGCGGAGCAGGGAGCTGGCGGCGACGGCCACAGGGGCG GCGACGGCGCTACGCACAGCGACCCAG |
||||
| Links |
UCSC Browser(chr10:19,868,795-19,868,886) IGTC(Ayu21-W431) |
||||
Homology Search Results
| [NM_008635] Mus musculus microtubule-associated protein 7 (Mtap7), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Map7) |
||||