Gene Name | microtubule-associated protein 7 | Gene Symbol | Map7 | |||
Chromosome | 10 | Genomic Location | chr10:19,868,000-20,002,000 | ![]() |
||
Synonyms | Mtap7, ste, MAP7, mshi, mste, R75000, E-MAP-115 | |||||
Links |
UCSC Genome Browser(chr10:19,868,000-20,002,000) NCBI Gene(17761) IGTC(Map7,8846) UNIGene(Mm.20928) |
MGI(1328328) KEGG GENES(mmu:17761) EST Profile(mm.20928) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB558982 | GSS Location | chr10:19,868,795-19,868,886 | Size | 92 |
Sequence | TCTCCCGGCGCGTCATCGGAGCACCATGGCGGAGCAGGGAGCTGGCGGCGACGGCCACAGGGGCG GCGACGGCGCTACGCACAGCGACCCAG |
||||
Links |
UCSC Browser(chr10:19,868,795-19,868,886) IGTC(Ayu21-W431) |
[NM_008635] Mus musculus microtubule-associated protein 7 (Mtap7), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Map7) |