ID 21-W433
Registered: 2009.12.05 Last update: 2013.09.20
| Gene Name | netrin 1 | Gene Symbol | Ntn1 | |||
| Chromosome | 11 | Genomic Location | chr11:68,020,000-68,220,000 |  |
||
| Synonyms | AI561871, BC019633, Netrin-1 | |||||
| Links |
UCSC Genome Browser(chr11:68,020,000-68,220,000) NCBI Gene(18208) IGTC(Ntn1,1046) UNIGene(Mm.39095) |
MGI(105088) KEGG GENES(mmu:18208) EST Profile(mm.39095) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB535730 | GSS Location | chr11:68,213,887-68,214,259 | Size | 287 |
| Sequence | TTCAACTCCCAGACCAACCCAAAGCTAAGCCCCCAGTTTGAAGCTAACCTGACAGGCCGCAGGAC CGGAGCGAGCCATTGAGATCTGGCAGCGTGACCCGTGAGCGAAGAACCGCGCGAAGGGCCGGGCA GGCGTGACACCACCTGGCGGAACCCCGGGGAAGAGTCTTAAAAGAGGGCGCTCCTCCGCTCCCGG AGCAATCCAGCAGGATCTACCCAGTGCTCACTTCCCTCCGCTGCCCAGCAGTCCCGTCCGCCCCA ACCCGCCCCCACCCGCCCCCACCGCAG |
||||
| Links |
UCSC Browser(chr11:68,213,887-68,214,259) IGTC(Ayu21-W433) |
||||
Homology Search Results
| [BY729287] BY729287 RIKEN full-length enriched, 7 days embryo whole body Mus musculus cDNA clone C430050H18 5', mRNA sequence. |
Mouse Information
| Card ID | 1912 | ||||
| Strain Name | B6;CB-<i>Ntn1<sup>Gt(pU-21W)433Card</sup></i> | ||||
| Internal Code | Ayu21-W433 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ntn1) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |