ID 21-W448
Registered: 2010.05.02 Last update: 2011.06.23
| Gene Name | leucine rich repeat containing 8D | Gene Symbol | Lrrc8d | |||
| Chromosome | 5 | Genomic Location | chr5:106,127,000-106,247,000 |  |
||
| Synonyms | Lrrc5, A930019F03, 2810473G09Rik, 4930525N13Rik | |||||
| Links |
UCSC Genome Browser(chr5:106,127,000-106,247,000) NCBI Gene(231549) IGTC(Lrrc8d,20658) UNIGene(Mm.23837) |
MGI(1922368) KEGG GENES(mmu:231549) EST Profile(mm.23837) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W230 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB558989 | GSS Location | chr5:106,161,247-106,161,393 | Size | 147 |
| Sequence | AGGAAGTGCACTGCTGACTGCAACGTGCTGCCGGCTCCCAGGATGGAGGAGTGAAGTCTCGCGTC GCAGCGGTTCCAGCCCCCGGAGCCTGCCCGCAGCCGAGTCCTCGAGAGCGCCCTGAGGGAGCAGG GTGGCCACCTGGTCCAG |
||||
| Links |
UCSC Browser(chr5:106,161,247-106,161,393) IGTC(Ayu21-W448) |
||||
Homology Search Results
| [NM_001122768] Mus musculus leucine rich repeat containing 8D (Lrrc8d), transcript variant 1, mRNA. |
Mouse Information
| Card ID | 1776 | ||||
| Strain Name | B6;CB-<i>Lrrc8d<sup>Gt(pU-21W)448Card</sup></i> | ||||
| Internal Code | Ayu21-W448 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Lrrc8d) |
||||