ID 21-W45
Registered: 2008.10.06 Last update: 2008.10.06
| Gene Name | CCR4-NOT transcription complex, subunit 2 | Gene Symbol | Cnot2 | |||
| Chromosome | 10 | Genomic Location | chr10:115,920,000-116,020,000 |  |
||
| Synonyms | ||||||
| Links |
UCSC Genome Browser(chr10:115,920,000-116,020,000) NCBI Gene(77068) IGTC(Cnot2,4027) UNIGene(Mm.351553) |
MGI(1919318) KEGG GENES(mmu:72068) EST Profile(mm.351553) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB462916 | GSS Location | chr10:116,018,509-116,018,567 | Size | 59 |
| Sequence | GCAGCCTCCGCGGTGGATACGTCGCCATCTTGGATCCGCGGGACAAGAAAATTCATGCG | ||||
| Links |
UCSC Browser(chr10:116,018,509-116,018,567) IGTC(Ayu21-W45) |
||||
Homology Search Results
| [BC065171] Mus musculus CCR4-NOT transcription complex, subunit 2, mRNA (cDNA clone MGC:90064 IMAGE:6415034), complete cds. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Cnot2) |
||||