Gene Name | ELAV like RNA binding protein 1 | Gene Symbol | Elavl2 | |||
Chromosome | 4 | Genomic Location | chr4:90,915,000-91,070,000 | ![]() |
||
Synonyms | Hub, mel-N1 | |||||
Links |
UCSC Genome Browser(chr4:90,915,000-91,070,000) NCBI Gene(15569) IGTC(Elavl2,13037) UNIGene(Mm.318042) |
MGI(1100887) KEGG GENES(mmu:15569) EST Profile(mm.318042) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB583688 | GSS Location | chr4:91,038,591-91,038,731 | Size | 141 |
Sequence | GTCACTGAGGCAGCAGCCGGTCGGTAGGGCGGGGTTCCGTCGTGTTCCAGTCCGCTTCCCGCCGC CGCCAGCGTGACTCCCTCTGAGCGGTGCTGTCGGCCGGCGGCGCGAGCCGTGGGAGCTGCAGCCG AGCCGCAGCAG |
||||
Links |
UCSC Browser(chr4:91,038,591-91,038,731) IGTC(Ayu21-W455) |
[NM_001177883] Mus musculus ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) (Elavl2), transcript variant 4, mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Elavl2) |