ID 21-W460
Registered: 2010.05.20 Last update: 2010.08.25
| Gene Name | UDP-glucose ceramide glucosyltransferase | Gene Symbol | Ugcg | |||
| Chromosome | 4 | Genomic Location | chr4:59,202,000-59,236,500 |  |
||
| Synonyms | Ugcgl, C80537, Epcs21, GlcT-1, AU043821 | |||||
| Links |
UCSC Genome Browser(chr4:59,202,000-59,236,500) NCBI Gene(22234) IGTC(Ugcg,22543) UNIGene(Mm.198803) |
MGI(1332243) KEGG GENES(mmu:22234) EST Profile(mm.198803) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB562514 | GSS Location | chr4:59,202,502-59,202,613 | Size | 112 |
| Sequence | CAGCGGGCCGGGGGATGGCGCTGCTGGACCTGGCCCAGGAGGGAATGGCCTTGTTCGGCTTCGTG CTCTTCGTGGTGCTGTGGCTGATGCATTTCATGTCCATCATCTACAC |
||||
| Links |
UCSC Browser(chr4:59,202,502-59,202,613) IGTC(Ayu21-W460) |
||||
Homology Search Results
| [NM_011673] Mus musculus UDP-glucose ceramide glucosyltransferase (Ugcg), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Ugcg) |
||||