ID 21-W465
Registered: 2010.08.29 Last update: 2010.09.11
| Gene Name | ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 | Gene Symbol | Acap2 | |||
| Chromosome | 16 | Genomic Location | chr16:31,090,000-31,203,000 |  |
||
| Synonyms | CNT-B2, Centb2, mKIAA0041, 4832442G16, 9530039J15Rik | |||||
| Links |
UCSC Genome Browser(chr16:31,090,000-31,203,000) NCBI Gene(78618) IGTC(Acap2,9639) UNIGene(Mm.274646) |
MGI(1925868) KEGG GENES(mmu:78618) EST Profile(mm.274646) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB583685 | GSS Location | chr16:31,201,025-31,201,248 | Size | 224 |
| Sequence | GTCTTCGCGGCTGCTATGCCCAGGGAGCGCAGCGCTCTCCGCAGCTCCGCGCAGCCCTAGAGGCA GCCGAGCGCCCGCCGACGCCGCCCGGATCCCCGGTGCCACCGCTACCCCGGTCCCGCAGCTCCCG CGGATCCTCCGGCGTTGCCTGTGAGGCCAGGAGGAGGCAAGATGAAGATGACGGTGGATTTCGAG GAGTGTCTGAAGGACTCGCCCCGCTTCAG |
||||
| Links |
UCSC Browser(chr16:31,201,025-31,201,248) IGTC(Ayu21-W465) |
||||
Homology Search Results
| [NM_030138] Mus musculus ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 (Acap2), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Acap2) |
||||