ID 21-W469
Registered: 2010.11.05 Last update: 2010.11.06
| Gene Name | signal-induced proliferation-associated 1 like 3 | Gene Symbol | Sipa1l3 | |||
| Chromosome | 7 | Genomic Location | chr7:30,105,000-30,305,000 |  |
||
| Synonyms | 2610511M17Rik | |||||
| Links |
UCSC Genome Browser(chr7:30,105,000-30,305,000) NCBI Gene(74206) IGTC(Sipa1l3,2628) UNIGene(Mm.375176) |
MGI(1921456) KEGG GENES(mmu:74206) EST Profile(mm.375176) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB598115 | GSS Location | chr7:30,303,484-30,303,659 | Size | 176 |
| Sequence | GCGCGCTGCTTCTTAGGGAGAAACTACAGTTCCCACGAGGCCTCGCGCGAAGCGGCTTGGAAGTG GGCAGCCTGGAAGTCACTCGGGCCACTGGAGCTGGCGGCGTCTCTAGCGAACCGCGCCGTGCTGA ACGCCGCGGTCGAGGAGCCCGCGGGGCGTGTGGCCGGTACGCCTAG |
||||
| Links |
UCSC Browser(chr7:30,303,484-30,303,659) IGTC(Ayu21-W469) |
||||
Homology Search Results
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Sipa1l3) |
||||