ID 21-W478
Registered: 2010.07.02 Last update: 2011.09.06
| Gene Name | epsin 2 | Gene Symbol | Epn2 | |||
| Chromosome | 11 | Genomic Location | chr11:61,325,000-61,395,000 |  |
||
| Synonyms | Ibp2, AA536924, 9530051D10Rik | |||||
| Links |
UCSC Genome Browser(chr11:61,325,000-61,395,000) NCBI Gene(13855) IGTC(Epn2,7635) UNIGene(Mm.139695) |
MGI(1333766) KEGG GENES(mmu:13855) EST Profile(mm.139695) |
||||
| Other Clone Trapped This Gene |
|---|
| K18B12 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB570399 | GSS Location | chr11:61,393,069-61,393,184 | Size | 116 |
| Sequence | CGGCCGCCATGTTGGCTGGCGTGTGGGTGTCAAACGCTGCACAGGCTCGGGTCGCTCCCGCTTCT CCCGCGTCGCCGGCGGCTGCAGCCTTGCACTCGCGCTGGCCAGGAACGGAG |
||||
| Links |
UCSC Browser(chr11:61,393,069-61,393,184) IGTC(Ayu21-W478) |
||||
Homology Search Results
| [NM_010148] Mus musculus epsin 2 (Epn2), mRNA. |
Mouse Information
| Card ID | 1758 | ||||
| Strain Name | B6;CB-<i>Epn2<sup>Gt(pU-21W)478Card</sup></i> | ||||
| Internal Code | Ayu21-W478 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Epn2) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |