Gene Name | charged multivesicular body protein 1A | Gene Symbol | Chmp1a | |||
Chromosome | 8 | Genomic Location | chr8:125,728,000-125,736,800 | ![]() |
||
Synonyms | Pcoln3, 2900018H07Rik | |||||
Links |
UCSC Genome Browser(chr8:125,728,000-125,736,800) NCBI Gene(234852) IGTC(Chmp1a,2304) UNIGene(Mm.41596) |
MGI(1920159) KEGG GENES(mmu:234852) EST Profile(mm.41596) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB601832 | GSS Location | chr8:125,736,566-125,736,660 | Size | 95 |
Sequence | GGCGACCCCGGAAGCCCTCGCGGAGACAGCGGGTCCGTAACATCGCGTCCCCTGCGCCGCCCCGA GGGCTGTGCTAGCCCGACCGGCCATGGACG |
||||
Links |
UCSC Browser(chr8:125,736,566-125,736,660) IGTC(Ayu21-W483) |
[NM_145606] Mus musculus chromatin modifying protein 1A (Chmp1a), mRNA. |
Card ID | |||||
Strain Name | |||||
Internal Code | |||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
Links |
IMSR (for Chmp1a) |