| Gene Name | myosin VA | Gene Symbol | Myo5a | |||
| Chromosome | 9 | Genomic Location | chr9:74,917,000-75,075,000 | |||
| Synonyms | d, Dbv, MVa, flr, Myo5, MyoVA, Sev-1, flail, d-120J, AI413174, AI661011, 9630007J19Rik | |||||
| Links |
UCSC Genome Browser(chr9:74,917,000-75,075,000) NCBI Gene(17918) IGTC(Myo5a,6290) UNIGene(Mm.3645) |
MGI(105976) KEGG GENES(mmu:17918) EST Profile(mm.3645) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB573682 | GSS Location | chr9:74,919,355-74,919,466 | Size | 112 |
| Sequence | GCCCGCCACCGTTTCACCCGCGCGGGCGGCCGCCACGCGAGCTGCGGCCTCCGCCTAGGCGGGGG GCGTCGGCGCTGGGCCCGCCATGGCCGCGTCCGAGCTCTACACCAAG |
||||
| Links |
UCSC Browser(chr9:74,919,355-74,919,466) IGTC(Ayu21-W485) |
||||
| [NM_010864] Mus musculus myosin VA (Myo5a), mRNA. |
| Card ID | 1779 | ||||
| Strain Name | B6;CB-<i>Myo5a<sup>Gt(pU-21W)485Card</sup></i> | ||||
| Internal Code | Ayu21-W485 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Myo5a) |
||||
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |