ID 21-W486
Registered: 2010.07.03 Last update: 2010.08.27
| Gene Name | myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11 | Gene Symbol | Mllt11 | |||
| Chromosome | 3 | Genomic Location | chr3:95,022,000-95,032,800 |  |
||
| Synonyms | Af1q, Zfp692, AI839562 | |||||
| Links |
UCSC Genome Browser(chr3:95,022,000-95,032,800) NCBI Gene(56772) IGTC(Mllt11,1000) UNIGene(Mm.402805) |
MGI(1929671) KEGG GENES(mmu:56772) EST Profile(mm.402805) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB570403 | GSS Location | chr3:95,032,007-95,032,159 | Size | 154 |
| Sequence | GTCACAGACGAGGGAGAAGGCGTGAGGAGACAAAGCCGTCACATCCGCGACAGCTTCCTTCAGCA GCCTCCTCCTCTCCAGTCCAGAGCCGACCCCCGAGCCCCTGAGGCATCCCTTCCGTCTTCGGAAC ACCCTAGTCATTCATTGCTAACAA |
||||
| Links |
UCSC Browser(chr3:95,032,007-95,032,159) IGTC(Ayu21-W486) |
||||
Homology Search Results
| [NM_019914] Mus musculus myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 11 (Mllt11), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Mllt11) |
||||