Gene Name | Erbb2 interacting protein | Gene Symbol | Erbin | |||
Chromosome | 13 | Genomic Location | chr13:104,605,000-104,714,000 | |||
Synonyms | Erbb2ip, mKIAA1225, 1700028E05Rik | |||||
Links |
UCSC Genome Browser(chr13:104,605,000-104,714,000) NCBI Gene(59079) IGTC(Erbin,13698) UNIGene(Mm.277354) |
MGI(1890169) KEGG GENES(mmu:59079) EST Profile(mm.277354) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB5670404 | GSS Location | chr13:104,710,326-104,710,405 | Size | 80 |
Sequence | GGGGCCCGGAGCCACTGAGGAAGGGCAGGGAACCATGTCAAGCCGAGCCTCGGGACGGCTGCCCT GAGACACCCTGAGAG |
||||
Links |
UCSC Browser(chr13:104,710,326-104,710,405) IGTC(Ayu21-W487) |
[NM_021563] Mus musculus Erbb2 interacting protein (Erbb2ip), transcript variant 2, mRNA. |
Card ID | 1777 | ||||
Strain Name | B6;CB-<i>Erbb2ip<sup>Gt(pU-21W)487Card</sup></i> | ||||
Internal Code | Ayu21-W487 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Erbin) |