ID 21-W495
Registered: 2010.07.15 Last update: 2010.08.27
| Gene Name | neural precursor cell expressed, developmentally down-regulted gene 4 | Gene Symbol | Nedd4 | |||
| Chromosome | 9 | Genomic Location | chr9:72,505,000-72,600,000 |  |
||
| Synonyms | Nedd4-1, Nedd4, Nedd4a | |||||
| Links |
UCSC Genome Browser(chr9:72,505,000-72,600,000) NCBI Gene(17999) IGTC(Nedd4,3386) UNIGene(Mm.279923) |
MGI(97297) KEGG GENES(mmu:17999) EST Profile(mm.279923) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T269, K8G11 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB571319 | GSS Location | chr9:72,510,238-72,510,420 | Size | 183 |
| Sequence | CCAGCGCGTCCCGGAGTGGGCCTCCTCCGCCGCAAGCGACGCCTCCTCCTCCTCTTCCTCTCTCC TTCTCTCTCGGTCTCTCGCTCTCTCTCGCCGCTGCAGCCTAGTAGGGGCGCTTCGTCCAGCATGA GCTCGGACATGGCAGCCGACGAGTCGGAGGCCCCAGTACTCTCGGAGGACGAG |
||||
| Links |
UCSC Browser(chr9:72,510,238-72,510,420) IGTC(Ayu21-W495) |
||||
Homology Search Results
| [AK144240] Mus musculus cDNA, RIKEN full-length enriched library, clone:G430146B02 product:neural precursor cell expressed, developmentally down-regulted gene 4, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Nedd4) |
||||