ID 21-W498
Registered: 2010.08.08 Last update: 2012.04.28
| Gene Name | SET and MYND domain containing 2 | Gene Symbol | Smyd2 | |||
| Chromosome | 1 | Genomic Location | chr1:191,704,000-191,747,000 |  |
||
| Synonyms | KMT3C, Zmynd14, 4930402C15, 1110020E07Rik | |||||
| Links |
UCSC Genome Browser(chr1:191,704,000-191,747,000) NCBI Gene(226830) IGTC(Smyd2,35160) UNIGene(Mm.156895) |
MGI(1915889) KEGG GENES(mmu:226830) EST Profile(mm.156895) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB575990 | GSS Location | chr1:191,745,986-191,746,167 | Size | 182 |
| Sequence | GCCGCCAGCATGCGCGCCGAGGCCCGCGGCGGCCTGGAGCGCTTCTGCAGTGCGGGCAAGGGCCG GGGGCTCCGCGCGCTGCGGCCCTTCCACGTGGGCGACCTCCTCTTCTCCTGCCCGGCCTACGCCT GCGTGCTCACCGTGGGCGAGCGGGGCCACCACTGCGAGTGCTGCTTCGCCAG |
||||
| Links |
UCSC Browser(chr1:191,745,986-191,746,167) IGTC(Ayu21-W498) |
||||
Homology Search Results
| [NM_026796] Mus musculus SET and MYND domain containing 2 (Smyd2), mRNA. |
Mouse Information
| Card ID | 1857 | ||||
| Strain Name | B6;CB-<i>Smyd2<sup>Gt(pU-21W)498Card</sup></i> | ||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Smyd2) |
||||