ID 21-W502
Registered: 2010.11.23 Last update: 2012.09.10
| Gene Name | family with sequence similarity 172, member A | Gene Symbol | Fam172a | |||
| Chromosome | 13 | Genomic Location | chr13:77,845,000-78,310,000 |  |
||
| Synonyms | 53-E6, pEN87, AF064782, 1110033M05Rik, 2610318O14Rik, 9430037D06Rik | |||||
| Links |
UCSC Genome Browser(chr13:77,845,000-78,310,000) NCBI Gene(68675) IGTC(Fam172a,14727) UNIGene(Mm.343005) |
MGI(1915925) KEGG GENES(mmu:68675) EST Profile(mm.343005) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB601834 | GSS Location | chr13:77,847,984-77,848,114 | Size | 131 |
| Sequence | GAACTTGGTCGGGGCGCGGATCTTGAGAGAGAAAGTCCGAGCCAGGGCGCAAGGGAGTTCGCCCA GAGATCTGGAAGGCCACGCCTCCTCGCACCTACCCTCTCAGCATTGCAGCTGGGGACAGAGCTCA G |
||||
| Links |
UCSC Browser(chr13:77,847,984-77,848,114) IGTC(Ayu21-W502) |
||||
Homology Search Results
| [NM_001163419] Mus musculus family with sequence similarity 172, member A (Fam172a), transcript variant 2, mRNA. |
Mouse Information
| Card ID | 1862 | ||||
| Strain Name | B6;CB-<i>Fam172a<sup>Gt(pU-21W)502Card</sup></i> | ||||
| Internal Code | Ayu21-W502 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Fam172a) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |