ID 21-W505
Registered: 2010.11.23 Last update: 2018.10.27
| Gene Name | methylsterol monoxygenase 1 | Gene Symbol | Msmo1 | |||
| Chromosome | 8 | Genomic Location | chr8:67,196,500-67,213,000 |  |
||
| Synonyms | Sc4mol, DESP4, ERG25, C78600, 1500001G16Rik | |||||
| Links |
UCSC Genome Browser(chr8:67,196,500-67,213,000) NCBI Gene(66234) IGTC(Msmo1,41002) UNIGene(Mm.30119) |
MGI(1913484) KEGG GENES(mmu:66234) EST Profile(mm.30119) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB601829 | GSS Location | chr8:67,212,305-67,212,374 | Size | 70 |
| Sequence | GAGGTAGTGAGGAGGCCGCTGCACCTGCCAGGACTTGCGCTTAGACCGCTGTCTGTCGCGGGGAC GCCAG |
||||
| Links |
UCSC Browser(chr8:67,212,305-67,212,374) IGTC(Ayu21-W505) |
||||
Homology Search Results
| [NM_025436] Mus musculus sterol-C4-methyl oxidase-like (Sc4mol), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Msmo1) |
||||