ID 21-W507
Registered: 2010.07.15 Last update: 2011.06.23
| Gene Name | anaphase promoting complex subunit 16 | Gene Symbol | Anapc16 | |||
| Chromosome | 10 | Genomic Location | chr10:59,450,000-59,466,500 |  |
||
| Synonyms | APC16, D10Ertd641e, 2310005G07Rik | |||||
| Links |
UCSC Genome Browser(chr10:59,450,000-59,466,500) NCBI Gene(52717) IGTC(Anapc16,2768) UNIGene(Mm.21793) |
MGI(1289325) KEGG GENES(mmu:52717) EST Profile(mm.21793) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB571324 | GSS Location | chr10:59,465,704-59,465,835 | Size | 133 |
| Sequence | GGCGCATGTACCGCCATCAAACTCCCACAGCTCAGGCGGGCGCGCGCACGCCGCCGTTTACGTCG TGGCGAGCGAGGCCGCACGGCTTCGTCCAAGGGGCGGGGCTGTCAGTCAAAGTGCACAAGCTGCT GAG |
||||
| Links |
UCSC Browser(chr10:59,465,704-59,465,835) IGTC(Ayu21-W507) |
||||
Homology Search Results
| [NM_025514] Mus musculus anaphase promoting complex subunit 16 (Anapc16), mRNA. |
Mouse Information
| Card ID | 1780 | ||||
| Strain Name | B6;CB-<i>Anapc16<sup>Gt(pU-21W)507Card</sup></i> | ||||
| Internal Code | Ayu21-W507 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Anapc16) |
||||