Gene Name | anaphase promoting complex subunit 16 | Gene Symbol | Anapc16 | |||
Chromosome | 10 | Genomic Location | chr10:59,450,000-59,466,500 | ![]() |
||
Synonyms | APC16, D10Ertd641e, 2310005G07Rik | |||||
Links |
UCSC Genome Browser(chr10:59,450,000-59,466,500) NCBI Gene(52717) IGTC(Anapc16,2768) UNIGene(Mm.21793) |
MGI(1289325) KEGG GENES(mmu:52717) EST Profile(mm.21793) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB571324 | GSS Location | chr10:59,465,704-59,465,835 | Size | 133 |
Sequence | GGCGCATGTACCGCCATCAAACTCCCACAGCTCAGGCGGGCGCGCGCACGCCGCCGTTTACGTCG TGGCGAGCGAGGCCGCACGGCTTCGTCCAAGGGGCGGGGCTGTCAGTCAAAGTGCACAAGCTGCT GAG |
||||
Links |
UCSC Browser(chr10:59,465,704-59,465,835) IGTC(Ayu21-W507) |
[NM_025514] Mus musculus anaphase promoting complex subunit 16 (Anapc16), mRNA. |
Card ID | 1780 | ||||
Strain Name | B6;CB-<i>Anapc16<sup>Gt(pU-21W)507Card</sup></i> | ||||
Internal Code | Ayu21-W507 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Anapc16) |