Gene Name | RNA binding motif protein 6 | Gene Symbol | Rbm6 | |||
Chromosome | 9 | Genomic Location | chr9:107,675,000-107,776,000 | ![]() |
||
Synonyms | g16, Def-3, KIAA4015, NY-LU-12, mKIAA4015, 4930506F14Rik | |||||
Links |
UCSC Genome Browser(chr9:107,675,000-107,776,000) NCBI Gene(19654) IGTC(Rbm6,4634) UNIGene(Mm.139926) |
MGI(1338037) KEGG GENES(mmu:19654) EST Profile(mm.139926) |
Other Clone Trapped This Gene |
---|
Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
Accession | AB571325 | GSS Location | chr9:107,774,980-107,775,150 | Size | 171 |
Sequence | GGGATTTGCGGCCGTACTTCATCTCCCGGCGGGCCCAGCGCTGAAGGCGGTGGCGCGACGCCTTT GTGGAAGCCGGAGCCCACCGGGAGGAAGTTCCGGTCTCCGGGACGCTGGGTCCGTGGCGGCCTCT GAGGAGGAGGAGAAGCGGGCCGCGGCGGCTACGCTGCTTTG |
||||
Links |
UCSC Browser(chr9:107,774,980-107,775,150) IGTC(Ayu21-W508) |
[NM_029169] Mus musculus RNA binding motif protein 6 (Rbm6), transcript variant 2, mRNA. |
Card ID | 1787 | ||||
Strain Name | B6;CB-<i>Rbm6<sup>Gt(pU-21W)508Card</sup></i> | ||||
Internal Code | Ayu21-W508 | ||||
Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
Links |
IMSR (for Rbm6) |