ID 21-W518
Registered: 2010.07.20 Last update: 2010.08.28
| Gene Name | Sec31 homolog A (S. cerevisiae) | Gene Symbol | Sec31a | |||
| Chromosome | 5 | Genomic Location | chr5:100,790,000-100,846,000 |  |
||
| Synonyms | ABP125, ABP130, HSPC275, Sec31l1, AU042160, 1810024J13Rik | |||||
| Links |
UCSC Genome Browser(chr5:100,790,000-100,846,000) NCBI Gene(69162) IGTC(Sec31a,7724) UNIGene(Mm.18634) |
MGI(1916412) KEGG GENES(mmu:69162) EST Profile(mm.18634) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB572051 | GSS Location | chr5:100,845,122-100,845,247 | Size | 126 |
| Sequence | GCGGCTGCCACGTTGGAGCGGAGCGTGGAGGTGGCCCTGGGCCGCGGAGGAGGGGCGGCGGCGGC GGATCCGGGGAGAGGCCGACGCTCGCCGGCTAACGCAGGACAGGTCGCTGAGGTCCGCCAG |
||||
| Links |
UCSC Browser(chr5:100,845,122-100,845,247) IGTC(Ayu21-W518) |
||||
Homology Search Results
| [NM_026969] Mus musculus Sec31 homolog A (S. cerevisiae) (Sec31a), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Sec31a) |
||||