ID 21-W524
Registered: 2010.07.20 Last update: 2011.10.31
| Gene Name | secretion associated Ras related GTPase 1B | Gene Symbol | Sar1b | |||
| Chromosome | 11 | Genomic Location | chr11:51,576,500-51,606,000 |  |
||
| Synonyms | CMRD, Sara2, Sara1b, RP23-79E13.9, 2310075M17Rik, 2900019I22Rik | |||||
| Links |
UCSC Genome Browser(chr11:51,576,500-51,606,000) NCBI Gene(66397) IGTC(Sar1b,20336) UNIGene(Mm.196592) |
MGI(1913647) KEGG GENES(mmu:66397) EST Profile(mm.196592) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB572056 | GSS Location | chr11:51,577,196-51,577,293 | Size | 98 |
| Sequence | GAGAAGAGCTGGGGCCCTGGCAGCCATAGCGCTTTGCACAGCCGGCTTGGAGCGTGTAGGACGGG CACGGAGCAGGGTTGCGTTCTCTGAAGTCGCAG |
||||
| Links |
UCSC Browser(chr11:51,577,196-51,577,293) IGTC(Ayu21-W524) |
||||
Homology Search Results
| [NM_025535] Mus musculus SAR1 gene homolog B (S. cerevisiae) (Sar1b), mRNA. |
Mouse Information
| Card ID | 1767 | ||||
| Strain Name | B6;CB-<i>Sar1b<sup>Gt(pU-21W)524Card</sup></i> | ||||
| Internal Code | Ayu21-W524 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Sar1b) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |