ID 21-W526
Registered: 2010.07.23 Last update: 2011.10.31
| Gene Name | diphosphoinositol pentakisphosphate kinase 2 | Gene Symbol | Ppip5k2 | |||
| Chromosome | 1 | Genomic Location | chr1:99,601,000-99,668,000 |  |
||
| Synonyms | Vip2, Hisppd1, AW555814, mKIAA0433, D330021B20 | |||||
| Links |
UCSC Genome Browser(chr1:99,601,000-99,668,000) NCBI Gene(227399) IGTC(Ppip5k2,9510) UNIGene(Mm.220817) |
MGI(2142810) KEGG GENES(mmu:227399) EST Profile(mm.220817) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB572861 | GSS Location | chr1:99,666,432-99,666,638 | Size | 207 |
| Sequence | AGGGAAGAGGCGTGTCGGAGGCTCCTGAGGTGTGCCAGTGCCAGCGGTTCCGCGGTGGCCGGCGA GGGAAGCTTCAGGTCCACGCCTCCGAGAGCCGCCTCGGCACAAGCGTCCTTCCCTCGCCCCCGCA ATTAAAGGGGGAGGAACCGAAACCTGGATGGGCTCAAGCATCTCCCGCAGATCGCTTGCTGCCCG CAGCCACGGCAG |
||||
| Links |
UCSC Browser(chr1:99,666,432-99,666,638) IGTC(Ayu21-W526) |
||||
Homology Search Results
| [NM_173760] Mus musculus diphosphoinositol pentakisphosphate kinase 2 (Ppip5k2), mRNA. |
Mouse Information
| Card ID | 1789 | ||||
| Strain Name | B6;CB-<i>Ppip5k2<sup>Gt(pU-21W)526Card</sup></i> | ||||
| Internal Code | Ayu21-W526 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Ppip5k2) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |