ID 21-W527
Registered: 2010.08.08 Last update: 2010.09.09
| Gene Name | tetraspanin 9 | Gene Symbol | Tspan9 | |||
| Chromosome | 6 | Genomic Location | chr6:127,910,000-128,100,000 |  |
||
| Synonyms | AU018597, 6720474K14Rik, 9430079M16Rik | |||||
| Links |
UCSC Genome Browser(chr6:127,910,000-128,100,000) NCBI Gene(109246) IGTC(Tspan9,3537) UNIGene(Mm.21814) |
MGI(1924558) KEGG GENES(mmu:109246) EST Profile(mm.21814) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T162, 21-W166, 21-KBW259 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB575991 | GSS Location | chr6:128,033,400-128,093,603 | Size | 173 |
| Sequence | GCCCCCCGTTTCCGCTGGCCGCCGCGGTGCGGGAGGGAGCGGAGCCGGGGCTGCCACACCGAGTC CAAGCGCGCGTTGCAGCTGGCGAAGACTTGGGAAGTCAGATCCAAGCTGTCCCCTNTCAGAGGAG AGTGAGAGGATCCAGCTCAGGTGACCCAGGCAGGCAGTCAGAG |
||||
| Links |
UCSC Browser(chr6:128,033,400-128,093,603) IGTC(Ayu21-W527) |
||||
Homology Search Results
| [BB857514] RIKEN full-length enriched, B16 F10Y cells Mus musculus cDNA clone G370044M16 5', mRNA sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Tspan9) |
||||