| Gene Name | epithelial cell adhesion molecule | Gene Symbol | Epcam | |||
| Chromosome | 17 | Genomic Location | chr17:88,035,000-88,051,000 | |||
| Synonyms | Egp314, Ep-CAM, gp40, EGP-2, TROP1, panepithelial glycoprotein 314, Ly74, GA733-2, EpCAM, CD326, Tacstd1 | |||||
| Links |
UCSC Genome Browser(chr17:88,035,000-88,051,000) NCBI Gene(17075) IGTC(Epcam,1992) UNIGene(Mm.4259) |
MGI(106653) KEGG GENES(mmu:17075) EST Profile(mm.4259) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W90 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB441713 | GSS Location | chr17:88,036,061-88,039,343 | Size | 282 |
| Sequence | CACAGCGCTCAGTCCGTCCGCCGCCGCGCAGCGCGACTGTCCTCCGAGCCGTCCCGCGCCGCACC TCCGCGAGTCGCCCTCGCCGCTCCGCGCGCAGCATGGCGGGTCCCCAGGCCCTCGCGTTCGGGCT CCTGCTCGCGGTGGTCACAGCGACGCTGGCCGCGGCTCAGAGAGACTGTGTCTGTGACAACTACA AGCTGGCAACAAGTTGCTCTCTGAATGAATATGGTGAATGCCAGTGTACTTCCTATGGTACACAG AATACTGTCATTTGCTCCAAAC |
||||
| Links |
UCSC Browser(chr17:88,036,061-88,039,343) IGTC(Ayu21-W53) |
||||
| [AK167182] Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched library, clone:I1C0037K16 product:tumor-associated calcium signal transducer 1, full insert sequence. |
| Card ID | 1196 | ||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Epcam) |
||||