ID 21-W533
Registered: 2010.07.20 Last update: 2018.10.28
| Gene Name | piezo-type mechanosensitive ion channel component 1 | Gene Symbol | Piezo1 | |||
| Chromosome | 8 | Genomic Location | chr8:125,029,000-125,076,000 |  |
||
| Synonyms | Fam38a, mKIAA0233, 9630020g22 | |||||
| Links |
UCSC Genome Browser(chr8:125,029,000-125,076,000) NCBI Gene(234839) IGTC(Piezo1,12878) UNIGene(Mm.476870) |
MGI(3603204) KEGG GENES(mmu:234839) EST Profile(mm.476870) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-W195 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB572060 | GSS Location | chr8:125,074,875-125,075,009 | Size | 135 |
| Sequence | GGTTCCTCCGGCCCTCGCACCTCCCTTTAGCCACGGCGGCGCGACCCCGGGCGGTCCCCCGGCCG CGGGGCATGGAGCCGCACGTGCTGGGCGCCGGGCTCTACTGGCTGTTGCTGCCCTGCACGCTCCT GGCGG |
||||
| Links |
UCSC Browser(chr8:125,074,875-125,075,009) IGTC(Ayu21-W533) |
||||
Homology Search Results
| [NM_001037298] Mus musculus family with sequence similarity 38, member A (Fam38a), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Piezo1) |
||||