ID 21-W545
Registered: 2010.08.08 Last update: 2010.09.09
| Gene Name | nitrogen permease regulator-like 3 (S. cerevisiae) | Gene Symbol | Nprl3 | |||
| Chromosome | 11 | Genomic Location | chr11:32,124,000-32,169,000 |  |
||
| Synonyms | Aag, Phg, Mare, HS-26, HS-40, Prox1, CGTHBA, m(alpha)RE | |||||
| Links |
UCSC Genome Browser(chr11:32,124,000-32,169,000) NCBI Gene(17168) IGTC(Nprl3,40884) UNIGene(Mm.) |
MGI(109258) KEGG GENES(mmu:17168) EST Profile(mm.) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB575994 | GSS Location | chr11:32,163,025-32,167,553 | Size | 202 |
| Sequence | GGGCTCCTGCAGGATGGGGGTACAATACCAGCCCCATCAGCGTGATCCTGGTGAGCTCGGGCAGC AGGGGCAATAAGCTGCTCTTCAGGTACCCCTTCCAGAGGAGCCAGGAGCACCCCGCGTCCCAGAC AAATAAACCACGGAGCAGATATGCTGTCAACAACACTGGCGAACATGCTGATGACCAGGACGGTG ACTCCAG |
||||
| Links |
UCSC Browser(chr11:32,163,025-32,167,553) IGTC(Ayu21-W545) |
||||
Homology Search Results
| [NM_181569] Mus musculus nitrogen permease regulator-like 3 (S. cerevisiae) (Nprl3), mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Nprl3) |
||||