ID 21-W55
Registered: 2008.06.18 Last update: 2008.06.18
| Gene Name | phenylalanine-tRNA synthetase 2 (mitochondrial) | Gene Symbol | Fars2 | |||
| Chromosome | 13 | Genomic Location | chr13:36,205,000-36,635,000 |  |
||
| Synonyms | Fars1 | |||||
| Links |
UCSC Genome Browser(chr13:36,205,000-36,635,000) NCBI Gene(69955) IGTC(Fars2,30481) UNIGene(Mm.70690) |
MGI(1917205) KEGG GENES(mmu:69955) EST Profile(mm.70690) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB441714 | GSS Location | chr13:36,209,727-36,209,874 | Size | 148 |
| Sequence | GGCCCTGGCCTCTTCCCGTCAAGATGGCGGCGCCCAGCGCGCCCAGCGTCTCGGTAGCCAGAGGT TAAGCTCAGTGACGGCGGAGTGAGTGTGTGGCCGCTTTGCGGACTTCGAAACGCCCGCGTTTGGT TTCCCCGGCGTACGCTGG |
||||
| Links |
UCSC Browser(chr13:36,209,727-36,209,874) IGTC(Ayu21-W55) |
||||
Homology Search Results
| [AK020164] Mus musculus 12 days embryo male wolffian duct includes surrounding region cDNA, RIKEN full-length enriched library, clone:6720478K01 product:SIMILAR TO PHENYLALANINE-TRNA SYNTHETASE homolog [Mus musculus], full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Fars2) |
||||