ID 21-W550
Registered: 2010.08.29 Last update: 2018.10.28
| Gene Name | sperm antigen with calponin homology and coiled-coil domains 1-like | Gene Symbol | Specc1l | |||
| Chromosome | 10 | Genomic Location | chr10:74,674,000-74,778,000 |  |
||
| Synonyms | Cytsa, Specc1l, AI317249, mKIAA0376, 4930470P14Rik, 4932439K10Rik, 9530057A13Rik | |||||
| Links |
UCSC Genome Browser(chr10:74,674,000-74,778,000) NCBI Gene(74392) IGTC(Specc1l,12928) UNIGene(Mm.27716) |
MGI(1921642) KEGG GENES(mmu:74392) EST Profile(mm.27716) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB583689 | GSS Location | chr10:74,674,818-74,674,964 | Size | 147 |
| Sequence | AAGGGAGACAGGGCGGGCCGAGGGAGCGGCGCCGTGGGGTTGGCTGTTGCCCTGAGGCCGGACTC AACGGACCGGGCCGCGCCACCGGGCGAGCTCGCCGCCCGGCCCCAGCCCGGAGCCAGCGAGTGAG CGAGGCGGTGCCGCGCG |
||||
| Links |
UCSC Browser(chr10:74,674,818-74,674,964) IGTC(Ayu21-W550) |
||||
Homology Search Results
| [NM_153406] Mus musculus cytospin A (Cytsa), transcript variant 2, mRNA. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Specc1l) |
||||