ID 21-W551
Registered: 2010.11.23 Last update: 2018.10.28
| Gene Name | zinc finger protein 976 | Gene Symbol | Zfp976 | |||
| Chromosome | 7 | Genomic Location | chr7:50,071,000-50,124,000 |  |
||
| Synonyms | 9830147E19Rik, C330019L16Rik | |||||
| Links |
UCSC Genome Browser(chr7:50,071,000-50,124,000) NCBI Gene(208111) IGTC(Zfp976,3466) UNIGene(Mm.387841) |
MGI(3036263) KEGG GENES(mmu:208111) EST Profile(mm.387841) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB601837 | GSS Location | chr7:50,122,494-50,122,618 | Size | 125 |
| Sequence | CCGGTCTCCCTGCTGCTGGTTCCATGTTGTAGCTGAGGAGAATGGAGTGGTTTGTGTGTCCTGCT CTGTGTGCTACTGCTGGATGCTGAGAGGGAAATTCAGGCGAGCTCTGACTTCGCGACATG |
||||
| Links |
UCSC Browser(chr7:50,122,494-50,122,618) IGTC(Ayu21-W551) |
||||
Homology Search Results
| [AK049289] Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330019L16 product:hypothetical protein, full insert sequence. |
Mouse Information
| Card ID | |||||
| Strain Name | |||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). This clone has not been subjected to chimeric mice production. | ||||
| Links |
IMSR (for Zfp976) |
||||