ID 21-W554
Registered: 2010.07.31 Last update: 2012.04.28
| Gene Name | inositol 1,3,4-triphosphate 5/6 kinase | Gene Symbol | Itpk1 | |||
| Chromosome | 12 | Genomic Location | chr12:103,805,000-103,950,000 |  |
||
| Synonyms | BC031182 | |||||
| Links |
UCSC Genome Browser(chr12:103,805,000-103,950,000) NCBI Gene(217837) IGTC(Itpk1,4965) UNIGene(Mm.482192) |
MGI(2446159) KEGG GENES(mmu:217837) EST Profile(mm.482192) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T242, 21-W232, 21-T169, 21-W231 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB573684 | GSS Location | chr12:103,942,932-103,943,122 | Size | 191 |
| Sequence | GAGGTGCCCGCACGCTCGCGGCGCGCGNCNGCCNCACACGCTCGGCCTGTGGGCAATTTCCTCCG GACCCAGGCTCCCGGGCCGAGGAGGAAGAAGATGCAGACCTTCCTGAAAGGGAAGAGAGTTGGCT ACTGGCTGAGCGAGAAGAAAGTCAAGAAGCTCAATTTCCAGGCCTTCGCGGAGCTGTGCAG |
||||
| Links |
UCSC Browser(chr12:103,942,932-103,943,122) IGTC(Ayu21-W554) |
||||
Homology Search Results
| [AK038913] Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched library, clone:A230074J21 product:INOSITOL 3,4,5,6 TETRAKISPHOSPHATE 1-KINASE/INOSITOL 1,3,4-TRISPHOSPHATE 5/6-KINASE homolog [Homo sapiens], full insert sequence. |
Mouse Information
| Card ID | 1858 | ||||
| Strain Name | B6;CB-<i>Itpk1<sup>Gt(pU-21W)554Card</sup></i> | ||||
| Internal Code | |||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Itpk1) |
||||