ID 21-W566
Registered: 2010.07.31 Last update: 2011.09.18
| Gene Name | trinucleotide repeat containing 6C | Gene Symbol | Tnrc6c | |||
| Chromosome | 11 | Genomic Location | chr11:117,513,000-117,627,000 |  |
||
| Synonyms | mKIAA1582, 9930033H14Rik | |||||
| Links |
UCSC Genome Browser(chr11:117,513,000-117,627,000) NCBI Gene(217351) IGTC(Tnrc6c,13766) UNIGene(Mm.40272) |
MGI(2443265) KEGG GENES(mmu:217351) EST Profile(mm.40272) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB573688 | GSS Location | chr11:117,516,595-117,563,714 | Size | 173 |
| Sequence | AGGCCCGCGCCGCCGGAGCCCCGCGGAGCCGCCGCCGGGGACGGAGCCCAGGGTAAAAGAACAGG AAACACAAGAAGAGGAACGTTTGATGGAAGAAAAGAAAAAGAAAAAGCAGGAAGACAAGAAAAAG AAGGAAGGTGCTCAGAAAAAGGCTGCTGATCAAAAAACCAAAG |
||||
| Links |
UCSC Browser(chr11:117,516,595-117,563,714) IGTC(Ayu21-W566) |
||||
Homology Search Results
| [NM_198022] Mus musculus trinucleotide repeat containing 6C (Tnrc6c), mRNA. |
Mouse Information
| Card ID | 1803 | ||||
| Strain Name | B6;CB-Tnrc6cGt(pU-21W)566Card | ||||
| Internal Code | Ayu21-W566 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Tnrc6c) |
||||