ID 21-W57
Registered: 2008.06.19 Last update: 2018.10.28
| Gene Name | SUZ RNA binding domain containing 1 | Gene Symbol | Szrd1 | |||
| Chromosome | 4 | Genomic Location | chr4:140,668,000-140,697,000 |  |
||
| Synonyms | D4Ertd22e | |||||
| Links |
UCSC Genome Browser(chr4:140,668,000-140,697,000) NCBI Gene(213491) IGTC(Szrd1,5237) UNIGene(Mm.332006) |
MGI(1098672) KEGG GENES(mmu:213491) EST Profile(mm.332006) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB3441715 | GSS Location | chr4:140,676,239-140,695,675 | Size | 120 |
| Sequence | GGGGAAAGCGGCGAGTAAGATGGAAGATGAGGAGGTCGCTGAGAGCTGGGAGGAGGCGGCAGACA GCGGGGAAATAGACAGACGGTTGGAAAAAAAACTGAAGATCACACAAAAAGAGAG |
||||
| Links |
UCSC Browser(chr4:140,676,239-140,695,675) IGTC(Ayu21-W57) |
||||
Homology Search Results
| [BY060224] BY060224 RIKEN full-length enriched, 17 days pregnant adult female amnion Mus musculus cDNA clone I920006E21 5-, mRNA sequence, gi|26165618|dbj|BY060224.1|[26165618] |
Mouse Information
| Card ID | 1200 | ||||
| Strain Name | B6;CB-D4Ertd22eGt(pU-21W)57Card | ||||
| Internal Code | Ayu21-W57 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). TMouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Szrd1) |
||||