ID 21-W578
Registered: 2010.08.08 Last update: 2011.10.31
| Gene Name | migration and invasion inhibitory protein | Gene Symbol | Miip | |||
| Chromosome | 4 | Genomic Location | chr4:147,234,500-147,243,000 |  |
||
| Synonyms | IIP45, AA553001, AI853621, D4Wsu114e | |||||
| Links |
UCSC Genome Browser(chr4:147,234,500-147,243,000) NCBI Gene(28010) IGTC(Miip,52598) UNIGene(Mm.250504) |
MGI(106506) KEGG GENES(mmu:28010) EST Profile(mm.250504) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB575999 | GSS Location | chr4:147,242,478-147,242,637 | Size | 160 |
| Sequence | CCGGGTGCTGGGAATCTGGGCTTTCGGGCGGAGAGCGTTGGCGTCCTTTTATCCATGGCAGCCGC TGATCTCGGGACCACAGAGGCGTGCCTTCGTCCCGCTAGACCGGTAGAGAAGGGGCAAGCGCCTA GGCCCCGGTGTGCACCCTGCCTGAGTGCGC |
||||
| Links |
UCSC Browser(chr4:147,242,478-147,242,637) IGTC(Ayu21-W578) |
||||
Homology Search Results
| [NM_001025365] Mus musculus migration and invasion inhibitory protein (Miip), mRNA. |
Mouse Information
| Card ID | 1805 | ||||
| Strain Name | B6;CB-MiipGt(pU-21W)578Card | ||||
| Internal Code | Ayu21-W578 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Miip) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |