ID 21-W590
Registered: 2010.08.08 Last update: 2012.04.28
| Gene Name | regulatory factor X, 3 (influences HLA class II expression) | Gene Symbol | Rfx3 | |||
| Chromosome | 19 | Genomic Location | chr19:27,835,000-28,088,000 |  |
||
| Synonyms | MRFX3, C230093O12Rik | |||||
| Links |
UCSC Genome Browser(chr19:27,835,000-28,088,000) NCBI Gene(19726) IGTC(Rfx3,7488) UNIGene(Mm.313321) |
MGI(106582) KEGG GENES(mmu:19726) EST Profile(mm.313321) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB576004 | GSS Location | chr19:28,085,462-28,085,604 | Size | 143 |
| Sequence | CATAGTCACCGTAGTCCTGGCGACTGTTACCCATCAACAACAACTACTCCTCTCCTCCTCCTCCT CCTCTTCCTCCTCCTCCTCCTCCCCACCACCACCATCTCCATCACCCACCAACAACACCACAATA ATCCACAGCCAAG |
||||
| Links |
UCSC Browser(chr19:28,085,462-28,085,604) IGTC(Ayu21-W590) |
||||
Homology Search Results
| [NM_011265] Mus musculus regulatory factor X, 3 (influences HLA class II expression) (Rfx3), transcript variant 1, mRNA. |
Mouse Information
| Card ID | 1860 | ||||
| Strain Name | B6;CB-<i>Rfx3<sup>Gt(pU-21W)590Card</sup></i> | ||||
| Internal Code | Ayu21-W590 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Rfx3) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |