ID 21-W6

Registered: 2008.03.14   Last update: 2017.02.05
Gene Name catenin (cadherin associated protein), delta 1 Gene Symbol Ctnnd1
Chromosome 2 Genomic Location chr2:84,440,000-84,493,000
Synonyms Catns, p120-catenin, Ctnnd, P120
Links UCSC Genome Browser(chr2:84,440,000-84,493,000)
NCBI Gene(12388)
IGTC(Ctnnd1,2210)
UNIGene(Mm.35738)
 MGI(105100)
KEGG GENES(mmu:12388)
EST Profile(mm.35738)
Other Clone Trapped This Gene
Trap Vector pU-21W Cell Line KTPU8 Method 5'-RACE
Accession AB427136 GSS Location chr2:84,490,563-84,490,729 Size 167
Sequence GAGCCAGCGAGCGAGACAGACACGGAGGGAGAGGAGAAAGGCAGGAAAGATCCTGGAACGAGGAA
GAGGAAGAGGCGGCGAACCTCGCTGGATTTGTCTTTCTCAGCACATTGGTGAAGCTTTGGGTTTG
TTTCTTAAAGGACTGGCTTTAGAAGTCCACATTTGAG
Links UCSC Browser(chr2:84,490,563-84,490,729)
IGTC(Ayu21-W6)

Homology Search Results

[BC054544] Mus musculus catenin (cadherin associated protein), delta 1, mRNA (cDNA clone MGC:62385 IMAGE:6408956), complete cds.

Mouse Information

Card ID 1304
Strain Name B6;CB-Ctnnd1Gt(pU-21W)6Card
Internal Code Ayu21-W6
Description This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE.
[Paper] "Development of an efficient screening system to identify novel bone metabolism-related genes using the exchangeable gene trap mutagenesis mouse models."Syuji Kurogi, Tomohisa Sekimoto, Taro Funamoto, Tomomi Ota, Shihoko Nakamura, Takuya Nagai, Mai Nakahara, Kumiko Yoshinobu, Kimi Araki, Masatake Araki and Etsuo Chosa, Sci. Rep., 7, 40692 (2017). doi: 10.1038/srep40692. PubMed ID:28106071.
Links IMSR (for Ctnnd1)

Expression Information

DescriptionX-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line.
Image Male Female