ID 21-W60
Registered: 2008.04.30 Last update: 2010.11.11
| Gene Name | LIM domain containing preferred translocation partner in lipoma | Gene Symbol | Lpp | |||
| Chromosome | 16 | Genomic Location | chr16:24,370,000-25,000,000 |  |
||
| Synonyms | C79715, AA959454, AU024130, D630048H16, 9430020K16Rik, B130055L10Rik | |||||
| Links |
UCSC Genome Browser(chr16:24,370,000-25,000,000) NCBI Gene(210126) IGTC(Lpp,2738) UNIGene(Mm.209385) |
MGI(2441849) KEGG GENES(mmu:210126) EST Profile(mm.209385) |
||||
| Other Clone Trapped This Gene |
|---|
| 21-T119, 21-MT133 |
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB435410 | GSS Location | chr16:24,442,864-24,457,028 | Size | 223 |
| Sequence | CAGGACCTGAAGAGAATCCTGACAGCTAGAGTGTTGGAAGAGGCTTGAAGAGAGGCCACACCCTC AGAGCTGCTTGGGACTCCTCTTGAGGGTGGTCTCCCACAGGAAGACTGGTGGGAACACAGGCTCA AGGACAGAAGGAGAGAGAGCGAGCCAGGTGCTTCTGCTTTTGTTACTTTTTCACCGTTCCCCCCA CTGGAGGGAAGACATTGTTCCTCAGTTG |
||||
| Links |
UCSC Browser(chr16:24,442,864-24,457,028) IGTC(Ayu21-W60) |
||||
Homology Search Results
| [AK169780] Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430022C14 product:LIPOMA PREFERRED partner, full insert sequence. |
Mouse Information
| Card ID | 1214 | ||||
| Strain Name | B6;CB-LppGt(pU-21W)60Card | ||||
| Internal Code | Ayu21-W60 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Lpp) |
||||
Expression Information
| Description | X-gal staining was performed for detecting β-galactosidase reporter expression in a wide variety of adult tissues of each trap line. |
|---|---|
| Image | Male Female |