ID 21-W63
Registered: 2008.06.19 Last update: 2009.09.06
| Gene Name | cut-like homeobox 1 | Gene Symbol | Cux1 | |||
| Chromosome | 5 | Genomic Location | chr5:136,720,000-137,048,000 |  |
||
| Synonyms | Cutl1, Cux-1, CDP, Cux | |||||
| Links |
UCSC Genome Browser(chr5:136,720,000-137,048,000) NCBI Gene(13047) IGTC(Cux1,1411) UNIGene(Mm.320317) |
MGI(88568) KEGG GENES(mmu:13047) EST Profile(mm.320317) |
||||
| Other Clone Trapped This Gene |
|---|
| Trap Vector | pU-21W | Cell Line | KTPU8 | Method | 5'-RACE |
| Accession | AB441716 | GSS Location | chr5:137,043,049-137,043,360 | Size | 312 |
| Sequence | GTCAAGGCTGCCGCCGCCGCCGCCGCCGCGTTTCCCTCAGGCTTCGGACTCCATGGCTGAGGCGG TGGCGGCTGCGGCGGGGGCAGCGGCGGCGGCGCCGTGAGGAGGAAGGAGTCCTCGTCCGCGGTGG CTGAGGCGGCGGCCGGCTCCAGGCCGGGTTTTGGCGCCCGCCCGCCTGCTGCCTCCTGGCGGCTC CTGAACTCCAGCCCCCTCTCTATCAGCCTCTCACTCCGTCTCAATATGTCTCAAGATGGCGGCCA ATGTGGGATCGATGTTTCAATATTGGAAGCGCTTTGATTTACAGCAGCTGCA |
||||
| Links |
UCSC Browser(chr5:137,043,049-137,043,360) IGTC(Ayu21-W63) |
||||
Homology Search Results
| [AK143193] Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130305D04 product:cut-like 1 (Drosophila), full insert sequence. |
Mouse Information
| Card ID | 1201 | ||||
| Strain Name | B6;CB-Cux1Gt(pU-21W)63Card | ||||
| Internal Code | Ayu21-W63 | ||||
| Description | This clone was isolated by using the exchangeable gene trap vector;pU-21W, and feeder free ES cell line; KTPU8 (F1 of B6 and CBA). Mouse line has been established from this clone, and deposited to the CARD R-BASE. | ||||
| Links |
IMSR (for Cux1) |
||||